1 1 Homo sapiens human taxon 9606 Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo 1 2 PRI 1 1 2 1q23.3 RefGeneTracking Status Provisional Assembly 0 accession Z30425.1 gi 458542 8114692 <Title_E> <Title_E_name>A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements.</Title_E_name> </Title_E> Baes M. Gulick T. Choi H.S. Martinoli M.G. Simha D. Moore D.D. Department of Molecular Biology, Massachusetts General Hospital, Boston 02114. <Title_E> <Title_E_iso-jta>Mol. Cell. Biol.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Mol Cell Biol</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0270-7306</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Molecular and cellular biology.</Title_E_name> </Title_E> 1994 3 14 3 1544-1552 eng 4 12 1994 3 1 0 1 8 1994 3 1 8114692 8020947 <Title_E> <Title_E_name>Assignment of the human peroxisome assembly factor-1 gene (PXMP3) responsible for Zellweger syndrome to chromosome 8q21.1 by fluorescence in situ hybridization.</Title_E_name> </Title_E> Masuno M. Shimozawa N. Suzuki Y. Kondo N. Orii T. Tsukamoto T. Osumi T. Fujiki Y. Imaizumi K. Kuroki Y. Department of Pediatrics, Gifu University School of Medicine, Japan. <Title_E> <Title_E_iso-jta>Genomics</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Genomics</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0888-7543</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Genomics.</Title_E_name> </Title_E> 1994 3 1 20 1 141-142 eng 4 12 1994 3 1 0 1 8 1994 3 1 S088875438471144X 8020947 9783588 <Title_E> <Title_E_name>Androstane metabolites bind to and deactivate the nuclear receptor CAR-beta.</Title_E_name> </Title_E> Forman B.M. Tzameli I. Choi H.S. Chen J. Simha D. Seol W. Evans R.M. Moore D.D. The City of Hope National Medical Center, Duarte, California 91010, USA. bforman@gte.net <Title_E> <Title_E_iso-jta>Nature</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Nature</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0028-0836</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Nature.</Title_E_name> </Title_E> 1998 10 8 395 6702 612-615 eng 4 12 2001 3 23 10 1 8 1998 10 23 2 1 10.1038/26996 9783588 12130689 <Title_E> <Title_E_name>Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor.</Title_E_name> </Title_E> Goodwin B. Hodgson E. D'Costa D.J. Robertson G.R. Liddle C. Department of Clinical Pharmacology and Storr Liver Unit, University of Sydney, Westmead Millennium Institute, Westmead, New South Wales, Australia. <Title_E> <Title_E_iso-jta>Mol. Pharmacol.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Mol Pharmacol</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0026-895X</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Molecular pharmacology.</Title_E_name> </Title_E> 2002 8 62 2 359-365 eng 4 12 2002 8 6 10 1 8 2002 7 20 10 0 12130689 GeneRIF: Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor. 12181452 <Title_E> <Title_E_name>Regulation of human CYP2C9 by the constitutive androstane receptor: discovery of a new distal binding site.</Title_E_name> </Title_E> Ferguson S.S. LeCluyse E.L. Negishi M. Goldstein J.A. Laboratory of Pharmacology & Chemistry, National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina 27709, USA. <Title_E> <Title_E_iso-jta>Mol. Pharmacol.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Mol Pharmacol</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0026-895X</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Molecular pharmacology.</Title_E_name> </Title_E> 2002 9 62 3 737-746 eng 4 12 2002 9 6 10 1 8 2002 8 16 10 0 12181452 GeneRIF: Regulation of human CYP2C9 by the constitutive androstane receptor: discovery of a new distal binding site. 12114525 <Title_E> <Title_E_name>Inhibitory cross-talk between estrogen receptor (ER) and constitutively activated androstane receptor (CAR). CAR inhibits ER-mediated signaling pathway by squelching p160 coactivators.</Title_E_name> </Title_E> Min G. Kim H. Bae Y. Petz L. Kemper J.K. Department of Molecular and Integrative Physiology, University of Illinois, Urbana, IL 61801, USA. <Title_E> <Title_E_iso-jta>J. Biol. Chem.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>J Biol Chem</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0021-9258</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The Journal of biological chemistry.</Title_E_name> </Title_E> 2002 9 13 277 37 34626-34633 eng 4 10 2002 7 11 12 2002 12 4 4 0 8 2002 7 13 10 0 M205239200 10.1074/jbc.M205239200 12114525 GeneRIF: CAR antagonizes ER-mediated transcriptional activity by squelching limiting amounts of p160 coactivators, such as SRC-1 and GRIP-1. 12049174 <Title_E> <Title_E_name>Specific and overlapping functions of the nuclear hormone receptors CAR and PXR in xenobiotic response.</Title_E_name> </Title_E> Wei P. Zhang J. Dowhan D.H. Han Y. Moore D.D. Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030, USA. <Title_E> <Title_E_iso-jta>Pharmacogenomics J.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Pharmacogenomics J</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>1470-269X</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The pharmacogenomics journal.</Title_E_name> </Title_E> 2002 2 2 117-126 eng 4 12 2002 12 18 4 0 8 2002 6 7 10 0 12049174 GeneRIF: CAR protein receptor is required for the induction of CYP2B10 expression in response to xenobiotics. 12376703 <Title_E> <Title_E_name>Modulation of acetaminophen-induced hepatotoxicity by the xenobiotic receptor CAR.</Title_E_name> </Title_E> Zhang J. Huang W. Chua S.S. Wei P. Moore D.D. Department of Molecular and Cellular Biology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030, USA. <Title_E> <Title_E_iso-jta>Science</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Science</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>1095-9203</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Science.</Title_E_name> </Title_E> 2002 10 11 298 5592 422-424 eng 4 12 2002 11 28 4 0 8 2002 10 12 4 0 298/5592/422 10.1126/science.1073502 12376703 GeneRIF: identified as a key regulator of acetaminophen metabolism and hepatotoxicity 12551939 <Title_E> <Title_E_name>Activation of orphan nuclear constitutive androstane receptor requires subnuclear targeting by peroxisome proliferator-activated receptor gamma coactivator-1 alpha. A possible link between xenobiotic response and nutritional state.</Title_E_name> </Title_E> Shiraki T. Sakai N. Kanaya E. Jingami H. Department of Molecular Biology, Biomolecular Engineering Research Institute, 6-2-3, Furuedai, Suita-City, Osaka 565-0874, Japan. <Title_E> <Title_E_iso-jta>J. Biol. Chem.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>J Biol Chem</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0021-9258</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The Journal of biological chemistry.</Title_E_name> </Title_E> 2003 3 28 278 13 11344-11350 eng 4 10 2003 1 27 12 2003 5 3 5 0 8 2003 1 29 4 0 M212859200 10.1074/jbc.M212859200 12551939 GeneRIF: activation requires subnuclear targeting by peroxisome proliferator-activated receptor gamma coactivator-1 alpha 12644700 <Title_E> <Title_E_name>Control of steroid, heme, and carcinogen metabolism by nuclear pregnane X receptor and constitutive androstane receptor.</Title_E_name> </Title_E> Xie W. Yeuh M.F. Radominska-Pandya A. Saini S.P. Negishi Y. Bottroff B.S. Cabrera G.Y. Tukey R.H. Evans R.M. Center for Pharmacogenetics and Department of Pharmaceutical Sciences, University of Pittsburgh, Pittsburgh, PA 15213, USA. <Title_E> <Title_E_iso-jta>Proc. Natl. Acad. Sci. U.S.A.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Proc Natl Acad Sci U S A</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0027-8424</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Proceedings of the National Academy of Sciences of the United States of America.</Title_E_name> </Title_E> 2003 4 1 100 7 4150-4155 eng 4 10 2003 3 18 12 2003 5 23 5 0 8 2003 3 20 4 0 0438010100 10.1073/pnas.0438010100 12644700 GeneRIF: control of steroid, heme, and carcinogen metabolism by this protein in transgenic mice 12644704 <Title_E> <Title_E_name>Induction of bilirubin clearance by the constitutive androstane receptor (CAR).</Title_E_name> </Title_E> Huang W. Zhang J. Chua S.S. Qatanani M. Han Y. Granata R. Moore D.D. Department of Molecular and Cellular Biology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030, USA. <Title_E> <Title_E_iso-jta>Proc. Natl. Acad. Sci. U.S.A.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Proc Natl Acad Sci U S A</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0027-8424</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Proceedings of the National Academy of Sciences of the United States of America.</Title_E_name> </Title_E> 2003 4 1 100 7 4156-4161 eng 4 10 2003 3 18 12 2003 5 23 5 0 8 2003 3 20 4 0 0630614100 10.1073/pnas.0630614100 12644704 GeneRIF: Induces bilirubin clearance when expressed in transgenic mice 12799447 <Title_E> <Title_E_name>Alternatively spliced isoforms of the human constitutive androstane receptor.</Title_E_name> </Title_E> Auerbach S.S. Ramsden R. Stoner M.A. Verlinde C. Hassett C. Omiecinski C.J. Department of Pharmacology, University of Washington, Seattle, WA, USA. <Title_E> <Title_E_iso-jta>Nucleic Acids Res.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Nucleic Acids Res</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>1362-4962</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Nucleic acids research.</Title_E_name> </Title_E> 2003 6 15 31 12 3194-3207 eng 4 12 2003 7 4 5 0 8 2003 6 12 5 0 12799447 GeneRIF: Alternatively spliced isoforms of the constitutive androstane receptor. 12397374 <Title_E> <Title_E_name>Crucial role of fibroblasts in regulating epidermal morphogenesis.</Title_E_name> </Title_E> El Ghalbzouri A. Lamme E. Ponec M. Department of Dermatology, Leiden University Medical Centre, Leiden, The Netherlands. <Title_E> <Title_E_iso-jta>Cell Tissue Res.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Cell Tissue Res</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0302-766X</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Cell and tissue research.</Title_E_name> </Title_E> 2002 11 310 2 189-199 eng 4 10 2002 9 7 2 2002 7 22 1 2002 3 10 12 2003 7 12 5 0 8 2002 10 25 4 0 10.1007/s00441-002-0621-0 12397374 12485946 <Title_E> <Title_E_name>Constitutive androstane receptor and pregnane X receptor gene expression in human liver: interindividual variability and correlation with CYP2B6 mRNA levels.</Title_E_name> </Title_E> Chang T.K. Bandiera S.M. Chen J. Faculty of Pharmaceutical Sciences, The University of British Columbia, Vancouver, British Columbia, Canada.tchang@unixg.ubc.ca <Title_E> <Title_E_iso-jta>Drug Metab. Dispos.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Drug Metab Dispos</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0090-9556</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Drug metabolism and disposition: the biological fate of chemicals.</Title_E_name> </Title_E> 2003 1 31 1 7-10 eng 4 12 2003 7 15 5 0 8 2002 12 18 4 0 12485946 GeneRIF: Substantial interindividual differences exist in hepatic constitutive androstane receptor expression; a 240-fold interindividual variability in hepatic mRNA levels has been detected. 12511605 <Title_E> <Title_E_name>Transcriptional analysis of the orphan nuclear receptor constitutive androstane receptor (NR1I3) gene promoter: identification of a distal glucocorticoid response element.</Title_E_name> </Title_E> Pascussi J.M. Busson-Le Coniat M. Maurel P. Vilarem M.J. Institut National de la Sante et de la Recherche Medicale, Federatif de Recherche No 24, 34293 Montpellier, France. pascussi@montp.inserm.fr <Title_E> <Title_E_iso-jta>Mol. Endocrinol.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>Mol Endocrinol</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0888-8809</Title_E_issn> </Title_E> <Title_E> <Title_E_name>Molecular endocrinology (Baltimore, Md.)</Title_E_name> </Title_E> 2003 1 17 1 42-55 eng 4 12 2003 7 18 5 0 8 2003 1 4 4 0 12511605 GeneRIF: A distal glucocorticoid response element located within the CAR promoter is described, and evidence is presented that this element is capable of of conferring trasncriptional activation via the glucocorticoid pathway. 12896978 <Title_E> <Title_E_name>Characterization of DNA complexes formed by the nuclear receptor constitutive androstane receptor.</Title_E_name> </Title_E> Frank C. Gonzalez M.M. Oinonen C. Dunlop T.W. Carlberg C. Department of Biochemistry, University of Kuopio, FIN-70211 Kuopio, Finland. <Title_E> <Title_E_iso-jta>J. Biol. Chem.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>J Biol Chem</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0021-9258</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The Journal of biological chemistry.</Title_E_name> </Title_E> 2003 10 31 278 44 43299-43310 eng 4 10 2003 8 1 12 2003 12 25 5 0 8 2003 8 5 5 0 M305186200 10.1074/jbc.M305186200 12896978 GeneRIF: CAR-RXR heterodimers and CAR monomers can contribute to the gene activating function of phenobarbital response enhancer modules in CAR target genes 15194709 <Title_E> <Title_E_name>Expression of constitutive androstane receptor splice variants in human tissues and their functional consequences.</Title_E_name> </Title_E> Lamba J.K. Lamba V. Yasuda K. Lin Y.S. Assem M. Thompson E. Strom S. Schuetz E. Department of Pharmaceutical Sciences, St. Jude Children's Research Hospital, 332 North Lauderdale Street, Memphis, TN 38105. erin.schuetz@stjude.org. <Title_E> <Title_E_iso-jta>J. Pharmacol. Exp. Ther.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>J Pharmacol Exp Ther</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0022-3565</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The Journal of pharmacology and experimental therapeutics.</Title_E_name> </Title_E> 2004 11 311 2 811-821 eng 4 12 2004 6 15 5 0 8 2004 6 15 5 0 10 2004 6 11 jpet.104.069310 10.1124/jpet.104.069310 15194709 15252010 <Title_E> <Title_E_name>The induction of cytochrome P450 3A5 (CYP3A5) in the human liver and intestine is mediated by the xenobiotic sensors pregnane X receptor (PXR) and constitutively activated receptor (CAR).</Title_E_name> </Title_E> Burk O. Koch I. Raucy J. Hustert E. Eichelbaum M. Brockm Zanger U.M. Wojnowski L. Dr. Margarete Fischer-Bosch Institute of Clinical Pharmacology, Auerbachstrasse 112, D-70376 Stuttgart, Germany. <Title_E> <Title_E_iso-jta>J. Biol. Chem.</Title_E_iso-jta> </Title_E> <Title_E> <Title_E_ml-jta>J Biol Chem</Title_E_ml-jta> </Title_E> <Title_E> <Title_E_issn>0021-9258</Title_E_issn> </Title_E> <Title_E> <Title_E_name>The Journal of biological chemistry.</Title_E_name> </Title_E> 2004 9 10 279 37 38379-38385 eng 4 10 2004 7 12 12 2004 10 20 9 0 8 2004 7 15 5 0 M404949200 10.1074/jbc.M404949200 15252010 GeneRIF: pregnane X receptor (PXR) and constitutively activated receptor (CAR) mediate induction of CYP3A5 in human liver and intestine 2004 10 28 NM_005122 2 32189358 3 Homo sapiens nuclear receptor subfamily 1, group I, member 3 (NR1I3), mRNA 1999 5 14 1336 CCTAACTCCAATCACTGGCAACTCCTGAGATCAGAGGAAAACCAGCAACAGCGTGGGAGTTTGGGGAGAGGCATTCCATACCAGATTCTGTGGCCTGCAGGTGACATGCTGCCTAAGAGAAGCAGGAGTCTGTGACAGCCACCCCAACACGTGACGTCATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAGGCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCACAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGCCCGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTGGGGTTCCAGGTAGAGTTTTTGGAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATGTGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGACCGACCTGGAGTTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGGTTTCTGTATGCGAAGTTGCTAGGCCTGCTGGCTGAGCTCCGGAGCATTAATGAGGCCTACGGGTACCAAATCCAGCACATCCAGGGCCTGTCTGCCATGATGCCGCTGCTCCAGGAGATCTGCAGCTGAGGCCATGCTCACTTCCTTCCCCAGCTCACCTGGAACACCCTGGATACACTGGAGTGGGAAAATGCTGGGACCAAAGATTGGGCCGGGTTCAAAGGGAGCCCAGTGGTTGCAATGAAAGACTAAAGCAAAAC 2003 6 25 4826660 NR1I3 CAR CAR1 MB67 CAR-SV4 CAR-SV8 CAR-BETA CAR-SV13 CAR-SV21 0 1335 32189358 GeneID 9970 LocusID 9970 MIM 603881 NP_005113 1 4826661 8 nuclear receptor subfamily 1, group I, member 3 [Homo sapiens] 1999 5 14 348 MASREDELRNCVVCGDQATGYHFNALTCEGCKGFFRRTVSKSIGPTCPFAGSCEVSKTQRRHCPACRLQKCLDAGMRKDMILSAEALALRRAKQAQRRAQQTPVQLSKEQEELIRTLLGAHTRHMGTMFEQFVQFRPPAHLFIHHQPLPTLAPVLPLVTHFADINTFMVLQVIKFTKDLPVFRSLPIEDQISLLKGAAVEICHIVLNTTFCLQTQNFLCGPLRYTIEDGARVGFQVEFLELLFHFHGTLRKLQLQEPEYVLLAAMALFSPDRPGVTQRDEIDQLQEEMALTLQSYIKGQQRRPRDRFLYAKLLGLLAELRSINEAYGYQIQHIQGLSAMMPLLQEICS nuclear receptor subfamily 1, group I, member 3 constitutive androstane receptor-beta; orphan nuclear hormone receptor constitutive androstane receptor SV4 constitutive androstane receptor SV8 constitutive androstane receptor SV13 constitutive androstane receptor SV21 4826661 1 4826661 158 1204 32189358 GeneOntology Function 0 text string androgen receptor activity go id 0004882 pubmed id 9783588 evidence TAS 0 text string transcription factor activity go id 0003700 pubmed id 8020947 evidence TAS 0 text string transcription factor activity go id 0003700 pubmed id 8114692 evidence TAS 0 text string transcription coactivator activity go id 0003713 pubmed id 9783588 evidence TAS Process 0 text string signal transduction go id 0007165 pubmed id 8020947 evidence TAS 0 text string signal transduction go id 0007165 pubmed id 9783588 evidence TAS 0 text string regulation of transcription, DNA-dependent go id 0006355 evidence IEA Component 0 text string nucleus go id 0005634 evidence IEA